adding numbers in a string

hi guys ... i need a way to determine the quality of reads from a DNA sequencing machine ... it generates lines like this:

HWI-EAS102_3:6:1:897:791:AATGTCAATCTGAGTTGCGATCGACCCTAGAAGTTT:40 40 40 40 40 40 22 23 40 40 40 31 15 25 24 27 29 22 23 5 23 11 21 7 10 11 12 16 -0 6 1 -3 9 -0 14 14

i have a little script that puts the numbers (always 36 of them to go with the 36 ACTG bases) that are separated by spaces at the end of the string into a scalar

#!/usr/bin/perl
open(SEQS,'<10scarflines');
open (OUT, '>qlines');
$qval = 0;
while (<SEQS>)
{
$read = $_;
$value = $read;
$value =~ s/^HWI-EAS102_\d+:\d+:\d+:\d+:\d+:\w+://;
print OUT "$value\n$read";
}

so for the sequence read:

HWI-EAS102_3:6:1:897:791:AATGTCAATCTGAGTTGCGATCGACCCTAGAAGTTT:40 40 40 40 40 40 22 23 40 40 40 31 15 25 24 27 29 22 23 5 23 11 21 7 10 11 12 16 -0 6 1 -3 9 -0 14 14

$value is

40 40 40 40 40 40 22 23 40 40 40 31 15 25 24 27 29 22 23 5 23 11 21 7 10 11 12 16 -0 6 1 -3 9 -0 14 14

I would like to be able to manipulate those numbers ... like take the average of the 36 ... or determine if there are negative numbers and how many ... how do i deal with them in perl?

(Ian, im using your hash script to great effect ... thx again)

RudyS

[edited by: phranque at 11:29 pm (utc) on Oct. 26, 2008]
[edit reason] disabled smileys ;) [/edit]

#!/usr/bin/perl
# to quiet warnings.
$tot=$tot_nums=$min=$max=$n=0;
open(SEQS,"test-dna.txt") or die("Cannot read file $!");
# chomp and store while reading
while (chomp($read=<SEQS>)) {
## split on the :, all we need are the numbers.
@raw = split(/:/,$read);
# pop returns the last item in the array, your nums
$nums = pop(@raw);
# split on spaces
@nums = split(/\s+/,$nums);
$tot_nums = $#nums+1; ## arrays are zero-based
# do the dirty work
foreach $n (@nums) {
$min = ($n<$min)?$n:$min;
$max = ($n>$max)?$n:$max;
$tot+=$n;
}
print "Total numbers: $tot_nums.\n";
print "Min: $min Max: $max\n";
## don't divide by 0.
if ($tot > 0) { print "average: " . $tot/$tot_nums . "\n"; }
}
close(SEQS);